Myrmecos - myrmecos.net - Myrmecos

Latest News:

Monday Night Mystery: Pick the Californians 27 Aug 2013 | 06:21 am

Tonight’s challenge requires not just skill in identifying insects, but knowledge about where they occur. Some of these insects were photographed in California. Some of them were not. To earn Myrmeco...

Sunday Night Movie: The Death of an Ant 26 Aug 2013 | 05:08 am

A short film by Alvaro Mendoza productions: The piece captures antlion hunting strategy perfectly. The sand pit by itself is only a partial trap; most insects can climb out on their own. But not with...

Another Sand Ridge Myrmica Headache 24 Aug 2013 | 11:32 pm

Since James has so cruelly dashed my hopes of having found Myrmica spatulata at Sand Ridge, I have this to say: How about this ant? Also photographed at Sand Ridge. Identifying Myrmica to species i...

Ant Hunting in a Rare Illinois Sand Prairie 23 Aug 2013 | 10:23 pm

It’s been too long since I’ve done a good old-fashioned anting expedition. So I took a break on Wednesday to see a part of Illinois rumored to be profoundly different from the rest of the state: Sand ...

Happy birthday to Mrs. Myrmecos 23 Aug 2013 | 07:08 am

I met Mrs. Myrmecos in August 2004 at a conference in Brisbane. I knew I was on to something good right away, because she let me photograph the ants in her back yard. Two years later, we married. In ...

Answer to the Monday Mystery 21 Aug 2013 | 11:18 pm

As many of you correctly surmised, the mystery orb was a monarch butterfly egg, Danaus plexippus. I was thrilled to see it because our monarch population crashed last year for reasons that still aren’...

Monday Night Mystery: Yay! 20 Aug 2013 | 06:00 am

Last Wednesday I took an unusually productive day trip to Sand Ridge State Forest in west-central Illinois. I recorded many entomological treasures, but I was especially happy to find this little gem:...

Sunday Night Movie: We Were All Female (AsapSCIENCE) 19 Aug 2013 | 04:02 am

Youtube is sprouting more informative science channels than I can count. One of the best is ASAPscience. Here’s their explainer of human sexual development:

Answer to last week’s mystery: Aphis nerii 18 Aug 2013 | 08:46 pm

I am just about the worst blogger ever this week. I’ve been out in the field around Illinois taking new photos (see right sidebar!) and neglecting my internet… um, responsibilities? Procrastinations?...

Monday Night Mystery: Match the Mystery DNA 13 Aug 2013 | 06:00 am

Here’s a challenge to test your molecular and your morphological mettle: GAAGAGACATTTGAAGATTTAGGAGAGGA CATTAACAATCACATAGAGTTATTGAAGTG Myrmecos points will be awarded for the first correct answers to...

Recently parsed news:

Recent searches: